View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21568_low_14 (Length: 252)

Name: NF21568_low_14
Description: NF21568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21568_low_14
NF21568_low_14
[»] chr2 (1 HSPs)
chr2 (12-237)||(32528231-32528456)


Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 12 - 237
Target Start/End: Original strand, 32528231 - 32528456
Alignment:
12 atgaaacaaacaaccgaagatgacactttctagtactaccaaaactgtctcttagctacttttagtactnnnnnnnntgatttagagagagaaatgtgat 111  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||    
32528231 atgaaacaaacaacctaagatgacactttctagtactaccaaaactgtctcttagctacttttagtactaaaaaaaatgatttagagagagaaatgtgat 32528330  T
112 ctacacaaaagacttgaactacatcttaggattgagtgtgacagaaagaaagttaatatgagagtaactctaggaacaaaataaggagagtggagcgaga 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32528331 ctacacaaaagacttgaactacatcttaggattgagtgtgacagaaagaaagttaatatgagagtaactctaggaacaaaataaggagagtggagcgaga 32528430  T
212 actttggcgaaaaatgagtgaatatt 237  Q
    ||||||||||||||||||||||||||    
32528431 actttggcgaaaaatgagtgaatatt 32528456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University