View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21568_low_19 (Length: 210)
Name: NF21568_low_19
Description: NF21568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21568_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 133 - 198
Target Start/End: Original strand, 2828940 - 2829005
Alignment:
| Q |
133 |
gcatgttctaatgtcgtacaactaggataggacacgtggtgtaataaagtaagactgtctgtgctc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2828940 |
gcatgttctaatgtcgtacaactaggataggacacgtggtgtaataaagtaagactgtctgtgctc |
2829005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University