View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21569_high_6 (Length: 279)
Name: NF21569_high_6
Description: NF21569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21569_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 129 - 272
Target Start/End: Original strand, 39734405 - 39734548
Alignment:
| Q |
129 |
gatcatcatggtgtggatgtggctgcagaggattctgatgagacatcactgattgttcttcatgatgggattctaagttgttggtttgatcaggtgcttg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39734405 |
gatcatcatggtgtggatgtggctgcagaggattatgatgagacatcactgattctttttcatgatgggattctaagttgttggtttgatcatgtgcttg |
39734504 |
T |
 |
| Q |
229 |
catgtccacggataaaccaccactcatgcttcttgttcatctca |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39734505 |
catgtccacggataaaccaccactcatgcttcttgttcttctca |
39734548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 3 - 131
Target Start/End: Original strand, 39734249 - 39734377
Alignment:
| Q |
3 |
cactcaaaggattaataatatagttagtgtgtgaagggaacatgactgcactacccactaaacgttcatcagacaccgttaattcagtttgaatgtgtgt |
102 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
39734249 |
cactcaaaggattaataatattgttagtgtgtgaagggaacatgactgcactacccactaaacgttcatcagacaccgttaatttactttgaatgtgtgt |
39734348 |
T |
 |
| Q |
103 |
ttctgttcccatcacaaccgtatgtggat |
131 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39734349 |
ttctgttcccatcacaaccgtatgtggat |
39734377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University