View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21569_low_5 (Length: 288)
Name: NF21569_low_5
Description: NF21569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21569_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 19 - 277
Target Start/End: Complemental strand, 40057000 - 40056741
Alignment:
| Q |
19 |
atgcactatgtgttaggtgattggaaattattttttcttttgacagaagataactaggaagttagtgcggtagttattctgttatcttctcata-caatg |
117 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
40057000 |
atgcactatgtgttaggtaattggaaattattttttcttttgacagaagataactaggaagttagtgcggtagttattctgttatcttcttataacaatg |
40056901 |
T |
|
| Q |
118 |
tttaatctccaattgagaggcaagtgaatcttaagacttataaagagatgcaattcattctaatgagaactattcttttcctacattattttcttctcaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40056900 |
tttaatctccaattgagaggcaagtgaatcttaagacttataaagagatgcaattcattctaatgagaactattcttttactacattattttcttctcaa |
40056801 |
T |
|
| Q |
218 |
atgttctctattctaattgctctctaaatcaataatcatgcaaaatactttttagttcat |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40056800 |
atgttctctattctaattgctctctaaatcaataatcatataaaatactttttagttcat |
40056741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University