View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2156_high_11 (Length: 217)
Name: NF2156_high_11
Description: NF2156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2156_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 44573650 - 44573445
Alignment:
| Q |
1 |
cacactttgatgcataaaaaacagccctaatttgtaatctttcttcttgnnnnnnnnnn-acttgaatcacttattttcacttttaataactaatcaact |
99 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44573650 |
cacactttgatgcataaaaaacagacctaatttcgaatctttcttcttgttgttttttttacttgaatcacttattttcacttttaataactaatcaatt |
44573551 |
T |
|
| Q |
100 |
aacataacagaaaatttgaatcgcacttttaacannnnnnnnnnggaggattttaacaattattatagagttaaatttatatctacataaaaaatatttt |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
44573550 |
aacataacagaaaatttgaatcacacttttaaca-tttttttttggaggattttaacaattattatagagttaaatttatatctaaataaaaaatatttt |
44573452 |
T |
|
| Q |
200 |
caatttc |
206 |
Q |
| |
|
||||||| |
|
|
| T |
44573451 |
caatttc |
44573445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University