View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2156_low_1 (Length: 450)
Name: NF2156_low_1
Description: NF2156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2156_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 14 - 289
Target Start/End: Complemental strand, 41376035 - 41375759
Alignment:
| Q |
14 |
aggcaacaaactcttttcttttgatacataatacagttcttcttttggaacacaatttactcaactagcttggcagtatagttaaaaatattcagcaaat |
113 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41376035 |
aggcaacaaactcttt-cttttgatacataatacagttcttcttttggaacacaatttactcaactagcttggcagtatagttaaaaatattcagcaaat |
41375937 |
T |
|
| Q |
114 |
atatacaggcgctgaagaagggatattagacgaatttccttttttgcaactggaactggtggaattaacaaaagtttactatagaaatatggctgaagaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41375936 |
atatacaggcgctgaagaagggatattagacgaatttccttttttgcaactggaactggtggaattaacaaaagtttactatagaaatatggctgaagaa |
41375837 |
T |
|
| Q |
214 |
ggttattgttttg--nnnnnnnnaactatagaaatatggctgaaaggtttggtttttagaacatcatatccttgggag |
289 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41375836 |
ggttattgttttgttttttttttaactatagaaatatggctgaaaggtttggtttttagaacatcatatccttgggag |
41375759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 113; E-Value: 5e-57
Query Start/End: Original strand, 297 - 429
Target Start/End: Complemental strand, 41375735 - 41375603
Alignment:
| Q |
297 |
agtggtttgaaataactagctatattttttggacaacctttcagaatgtggttatggatcaatgagctcattttctccctatgagcagctctctttctag |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41375735 |
agtggtttgaaataactagctatattttttggacaacctttcagaatgtggttatgaatcaatgagctcattttctccctatgagcagctttctttctag |
41375636 |
T |
|
| Q |
397 |
ttttaaaacttatatgatggacattataaatat |
429 |
Q |
| |
|
||| ||| |||||||||||||||||||||||| |
|
|
| T |
41375635 |
tttaaaactttatatgatggacattataaatat |
41375603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University