View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2156_low_10 (Length: 227)
Name: NF2156_low_10
Description: NF2156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2156_low_10 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 25811528 - 25811754
Alignment:
| Q |
1 |
tttgtttcttagaacttctcatcatcgaaagtaattatatttaagatgtatcaaactctcaacatgtgtatttctctcaactaagattgaaatcttgatc |
100 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25811528 |
tttgtttctcaaaacttctcatcatcgaaagtaattatatttaagatgtatcaaactctgaacatgtgtatttctctcaactaagattgaaatcttgatc |
25811627 |
T |
 |
| Q |
101 |
cacatccactttagtagtcatctccttccgctagatccaacctcattgatgtcccaaaataacattttactccaattttacatgcatatcctttaatctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25811628 |
cacatccactttagtagtcatctccttccgctagacccaacctcattgatgtcccaaaataacattttactccaattttacatgcatatcctttaatctt |
25811727 |
T |
 |
| Q |
201 |
ctatgaacatatgtttcatactatcaa |
227 |
Q |
| |
|
||||||||| |||||||||||||||| |
|
|
| T |
25811728 |
ttatgaacatgtgtttcatactatcaa |
25811754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University