View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2156_low_2 (Length: 314)

Name: NF2156_low_2
Description: NF2156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2156_low_2
NF2156_low_2
[»] chr6 (2 HSPs)
chr6 (58-189)||(27734909-27735040)
chr6 (17-45)||(27734849-27734877)


Alignment Details
Target: chr6 (Bit Score: 128; Significance: 4e-66; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 58 - 189
Target Start/End: Original strand, 27734909 - 27735040
Alignment:
58 tcgaaaaattacgaggtttttgtaaagtggagatttttatgaggtgaattgaagtattatcaagatctgacatttacattggagaatgaaattctagggt 157  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27734909 tcgaaaaattacgaggtttttgtaaagtgtagatttttatgaggtgaattgaagtattatcaagatctgacatttacattggagaatgaaattctagggt 27735008  T
158 tgtgtatgaagaataagaaaaatggggtatgc 189  Q
    ||||||||||||||||||||||||||||||||    
27735009 tgtgtatgaagaataagaaaaatggggtatgc 27735040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 17 - 45
Target Start/End: Original strand, 27734849 - 27734877
Alignment:
17 aaagggtatccaaaaaatccaacaaaccc 45  Q
    |||||||||||||||||||||||||||||    
27734849 aaagggtatccaaaaaatccaacaaaccc 27734877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University