View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2156_low_5 (Length: 249)

Name: NF2156_low_5
Description: NF2156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2156_low_5
NF2156_low_5
[»] chr4 (1 HSPs)
chr4 (1-160)||(44573285-44573440)


Alignment Details
Target: chr4 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 44573440 - 44573285
Alignment:
1 aacatgatatttccggcccaataatgaaaggagtaaagtagtgaatcttggcaacttgaaatttgattattgaaccaattggatttaagtttaatggaag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44573440 aacatgatatttccggcccaataatgaaaggagtaaagtagtgaaacttggcaacttgaaatttgattattgaaccaattggatttaagtttaatggaag 44573341  T
101 aagtcggactctccaatatgatgaattaatgtttgaatttcaattgggataaatacatat 160  Q
    ||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||    
44573340 aagtcggactctccaatatg----attaatgtttgaatttcaattgggataaatacatat 44573285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University