View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2156_low_8 (Length: 238)
Name: NF2156_low_8
Description: NF2156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2156_low_8 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 25812129 - 25811909
Alignment:
| Q |
18 |
caagattagtctctgatctcgagtgtttgatttgatgatgttgttgatacttgatatgatgnnnnnnnnnattttgaggtttgagaatgtgaatgaatga |
117 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25812129 |
caagattagtctgtgatctcgagtgcttgatttgatgatgttgttgatacttgatatgatgtttttttttattttgaggtttgagaatgtgaatgaatga |
25812030 |
T |
|
| Q |
118 |
atggatggttttggtgtctttggaaaagaaaggagagaagttaaataagtggaggttttttgaaaggacaaaggaggaaggacaaggttcagtatttcag |
217 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25812029 |
aaggatggttttggtgtctttggaaaagaaaggagagaagttaaataagtggaggttttttgaaaggacaaaggaggaaggacaaggttcagtatttcag |
25811930 |
T |
|
| Q |
218 |
ttagttttgtagttattggat |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
25811929 |
ttagttttgtagttattggat |
25811909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University