View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2156_low_8 (Length: 238)

Name: NF2156_low_8
Description: NF2156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2156_low_8
NF2156_low_8
[»] chr7 (1 HSPs)
chr7 (18-238)||(25811909-25812129)


Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 25812129 - 25811909
Alignment:
18 caagattagtctctgatctcgagtgtttgatttgatgatgttgttgatacttgatatgatgnnnnnnnnnattttgaggtttgagaatgtgaatgaatga 117  Q
    |||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||    
25812129 caagattagtctgtgatctcgagtgcttgatttgatgatgttgttgatacttgatatgatgtttttttttattttgaggtttgagaatgtgaatgaatga 25812030  T
118 atggatggttttggtgtctttggaaaagaaaggagagaagttaaataagtggaggttttttgaaaggacaaaggaggaaggacaaggttcagtatttcag 217  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25812029 aaggatggttttggtgtctttggaaaagaaaggagagaagttaaataagtggaggttttttgaaaggacaaaggaggaaggacaaggttcagtatttcag 25811930  T
218 ttagttttgtagttattggat 238  Q
    |||||||||||||||||||||    
25811929 ttagttttgtagttattggat 25811909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University