View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21570_high_12 (Length: 252)
Name: NF21570_high_12
Description: NF21570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21570_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 16 - 129
Target Start/End: Complemental strand, 5539282 - 5539169
Alignment:
| Q |
16 |
atttcattgtgccgtattagtcctttatgtctttttgttcaagtagatccttaacaaacagaaatggaaaggcttcacactcagcatggtgcaactatga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5539282 |
atttcattgtgccgtattagtcctttatgtctttttgtttaagtagatccttaacaaacagaaatggaaaggcttcacactcagcatggtgcaactatga |
5539183 |
T |
|
| Q |
116 |
tgatctaaatgagt |
129 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
5539182 |
tgatctaaatgagt |
5539169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 192 - 238
Target Start/End: Complemental strand, 5539066 - 5539020
Alignment:
| Q |
192 |
caggtcacttgattgcttttctcttggatggcctatgcgtgatgatg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5539066 |
caggtcacttgattgcttttctcttggatggcctataggtgatgatg |
5539020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 74 - 129
Target Start/End: Complemental strand, 39166348 - 39166293
Alignment:
| Q |
74 |
cagaaatggaaaggcttcacactcagcatggtgcaactatgatgatctaaatgagt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39166348 |
cagaaatggaaaggcttcacactcagcatggtccaactatgatgatctaaatgagt |
39166293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 192 - 238
Target Start/End: Complemental strand, 39166190 - 39166144
Alignment:
| Q |
192 |
caggtcacttgattgcttttctcttggatggcctatgcgtgatgatg |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39166190 |
caggtcacttgattgcttttctcttggatggcctatgcgtgatgatg |
39166144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 192 - 238
Target Start/End: Complemental strand, 43963681 - 43963635
Alignment:
| Q |
192 |
caggtcacttgattgcttttctcttggatggcctatgcgtgatgatg |
238 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43963681 |
caggacacctgattgcttttctcttggatggcccatgcgtgatgatg |
43963635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 129
Target Start/End: Complemental strand, 43963851 - 43963796
Alignment:
| Q |
74 |
cagaaatggaaaggcttcacactcagcatggtgcaactatgatgatctaaatgagt |
129 |
Q |
| |
|
||||||||||| |||| | |||||||| |||||||| || |||||||||||||||| |
|
|
| T |
43963851 |
cagaaatggaatggctcctcactcagcctggtgcaattacgatgatctaaatgagt |
43963796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University