View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21570_high_15 (Length: 218)
Name: NF21570_high_15
Description: NF21570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21570_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 2224245 - 2224046
Alignment:
| Q |
1 |
tggatgactataacacttatgttgtctttgcttcccttagccatagccaattcagctaagattgcagcagcctctgctgcataacttttaatagtgtgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2224245 |
tggatgactataacacttatgttgtctttgcttcccttagccatagccaattcagctaagattgcagcagcctctgctgcataacttttaatagtgtgat |
2224146 |
T |
|
| Q |
101 |
tgtgaacttctttcatattatgcctcctcatatgaccttgaaggcaacttctaacaacttcacaaacaaaattacttgatactacatcccaaagaccatc |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2224145 |
tgtgatcttctttcatattatgcctcctcatatgaccttgaaggcaacttctaacaacttcacaaacaaaattatttgatactacatcccaaagaccatc |
2224046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University