View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21570_high_16 (Length: 215)

Name: NF21570_high_16
Description: NF21570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21570_high_16
NF21570_high_16
[»] chr3 (2 HSPs)
chr3 (37-198)||(28292418-28292579)
chr3 (100-184)||(43069818-43069902)
[»] chr2 (1 HSPs)
chr2 (100-198)||(39035480-39035578)


Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 37 - 198
Target Start/End: Original strand, 28292418 - 28292579
Alignment:
37 tttatgtttaaatagcacaactctaattattctaacggtagtataaacattttgatatttgtcaggaccagcgagatgttaccggcaaattaagaacaaa 136  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28292418 tttatgtttaaatagcacaactctaattattctaacggtagtataaacattttgatatttgtcaggaccagcgagatgttaccggcaaattaagaacaaa 28292517  T
137 ccataccctaagtcacgattctgtcgcggtgtaccagatccaaagatccgaatctatgatgt 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28292518 ccataccctaagtcacgattctgtcgcggtgtaccagatccaaagatccgaatctatgatgt 28292579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 100 - 184
Target Start/End: Original strand, 43069818 - 43069902
Alignment:
100 aggaccagcgagatgttaccggcaaattaagaacaaaccataccctaagtcacgattctgtcgcggtgtaccagatccaaagatc 184  Q
    |||||| || || |||||||| |||||||||||||| ||||| || ||||| || |||||||| ||||| || ||||| ||||||    
43069818 aggacctgcaaggtgttaccgtcaaattaagaacaagccatatccaaagtcccgtttctgtcgtggtgttcctgatcccaagatc 43069902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 100 - 198
Target Start/End: Complemental strand, 39035578 - 39035480
Alignment:
100 aggaccagcgagatgttaccggcaaattaagaacaaaccataccctaagtcacgattctgtcgcggtgtaccagatccaaagatccgaatctatgatgt 198  Q
    |||||| || || |||||||| |||||||||||||| ||||| || || |||||||||||||| || || || ||||| |||||| | || ||||||||    
39035578 aggacctgctaggtgttaccgtcaaattaagaacaagccatatccaaaatcacgattctgtcgtggagttcctgatccgaagatcaggatttatgatgt 39035480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University