View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21570_low_13 (Length: 252)

Name: NF21570_low_13
Description: NF21570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21570_low_13
NF21570_low_13
[»] chr1 (2 HSPs)
chr1 (16-129)||(5539169-5539282)
chr1 (192-238)||(5539020-5539066)
[»] chr8 (2 HSPs)
chr8 (74-129)||(39166293-39166348)
chr8 (192-238)||(39166144-39166190)
[»] chr3 (2 HSPs)
chr3 (192-238)||(43963635-43963681)
chr3 (74-129)||(43963796-43963851)


Alignment Details
Target: chr1 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 16 - 129
Target Start/End: Complemental strand, 5539282 - 5539169
Alignment:
16 atttcattgtgccgtattagtcctttatgtctttttgttcaagtagatccttaacaaacagaaatggaaaggcttcacactcagcatggtgcaactatga 115  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5539282 atttcattgtgccgtattagtcctttatgtctttttgtttaagtagatccttaacaaacagaaatggaaaggcttcacactcagcatggtgcaactatga 5539183  T
116 tgatctaaatgagt 129  Q
    ||||||||||||||    
5539182 tgatctaaatgagt 5539169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 192 - 238
Target Start/End: Complemental strand, 5539066 - 5539020
Alignment:
192 caggtcacttgattgcttttctcttggatggcctatgcgtgatgatg 238  Q
    ||||||||||||||||||||||||||||||||||||  |||||||||    
5539066 caggtcacttgattgcttttctcttggatggcctataggtgatgatg 5539020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 74 - 129
Target Start/End: Complemental strand, 39166348 - 39166293
Alignment:
74 cagaaatggaaaggcttcacactcagcatggtgcaactatgatgatctaaatgagt 129  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
39166348 cagaaatggaaaggcttcacactcagcatggtccaactatgatgatctaaatgagt 39166293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 192 - 238
Target Start/End: Complemental strand, 39166190 - 39166144
Alignment:
192 caggtcacttgattgcttttctcttggatggcctatgcgtgatgatg 238  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
39166190 caggtcacttgattgcttttctcttggatggcctatgcgtgatgatg 39166144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 192 - 238
Target Start/End: Complemental strand, 43963681 - 43963635
Alignment:
192 caggtcacttgattgcttttctcttggatggcctatgcgtgatgatg 238  Q
    |||| ||| |||||||||||||||||||||||| |||||||||||||    
43963681 caggacacctgattgcttttctcttggatggcccatgcgtgatgatg 43963635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 74 - 129
Target Start/End: Complemental strand, 43963851 - 43963796
Alignment:
74 cagaaatggaaaggcttcacactcagcatggtgcaactatgatgatctaaatgagt 129  Q
    ||||||||||| |||| | |||||||| |||||||| || ||||||||||||||||    
43963851 cagaaatggaatggctcctcactcagcctggtgcaattacgatgatctaaatgagt 43963796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University