View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21570_low_18 (Length: 207)
Name: NF21570_low_18
Description: NF21570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21570_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 17 - 187
Target Start/End: Original strand, 19171003 - 19171174
Alignment:
| Q |
17 |
tgaacaagatataatgagtaacacaaagggtttcagcaatagaaagaataggtgaaatcaatgtcatgtcatgaatgaatgaagataaaggtggtgaaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19171003 |
tgaacaagatataatgagtaacacaaagggtttcagcaataggaagactaggtgaaatcaatgtcatgtcatagatgaatgaagataaaggtggtgaaag |
19171102 |
T |
 |
| Q |
117 |
tgaagcaagaagaggggatagaaggtgtggagagctacg-atcgatgtaaattgttggtaaaaaggatcaac |
187 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||| ||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
19171103 |
tgaagcaagaagaggtgatagaaggtgtgaagagcaacgtatcgatgcaaattgttggtaaaaaggatcaac |
19171174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University