View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21571_high_17 (Length: 319)
Name: NF21571_high_17
Description: NF21571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21571_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 2 - 211
Target Start/End: Complemental strand, 2447078 - 2446869
Alignment:
| Q |
2 |
atattttctatagattaataaggattcctaataacatatggcatgaaattcttaccctttttcaaatgttgtcgtacctttgaacttttgatttgggcca |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2447078 |
atattttctatagattaataaggattcctaataacatatggcatgaaattcttaccctttttcaaatgttgtcgtacctttgaacttttgatttgggcca |
2446979 |
T |
|
| Q |
102 |
aacttttgaaaagattgagtcatgtgttgaccaccttttggagctttcttgtaccactgatcagttgaaacattttaaggaggaacataatttgtcttca |
201 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2446978 |
aacttttgaaaagattgagtcttgtgttgaccaccttttggagctttcttgtaccactgatcagttgaaacattttaaggaggaacataatttatcttca |
2446879 |
T |
|
| Q |
202 |
aatgtggagg |
211 |
Q |
| |
|
|||||||||| |
|
|
| T |
2446878 |
aatgtggagg |
2446869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 209 - 314
Target Start/End: Complemental strand, 2446844 - 2446738
Alignment:
| Q |
209 |
aggccaacaagcattttgttggtaagaaggccaagactggcccttacaacttacaacattggtttgtgcttcaccc-tcttcatttcctctttgtctctc |
307 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
2446844 |
aggcaaacaagcattttgttggtaagaaggccaagactggcccttacaacttacaacattggtttgtgcttcacccttcttcatttcctttttgtctctt |
2446745 |
T |
|
| Q |
308 |
tgcttct |
314 |
Q |
| |
|
||||||| |
|
|
| T |
2446744 |
tgcttct |
2446738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University