View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21571_low_2 (Length: 229)
Name: NF21571_low_2
Description: NF21571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21571_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 75 - 199
Target Start/End: Complemental strand, 19991027 - 19990888
Alignment:
| Q |
75 |
ttttgctattgctataatgattgcatacttgtttggaatttgttttgcatttgatattcatgttaccaattgca---------------tatttatttgc |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19991027 |
ttttgctattgctataatgattgcatacttgtttggaatttgttttgcatttgatattcatgttaccaattgcatattgatttattgcatatttatttgc |
19990928 |
T |
 |
| Q |
160 |
atttagtctacatttcctttttgcttgtatgtattgcata |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19990927 |
atttagtctacatttcctttttgcttgtatgtattgcata |
19990888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 19991074 - 19991160
Alignment:
| Q |
1 |
agaaagtttagaagatcaatgaggtttgtatgccaacc-------tcccagcccaaagagacaaaatcttccacacaatatttttgc |
80 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19991074 |
agaaagtttagaagatcaatgaggtttctatgccaacctcgaacctcccagcccaaagagacaaaatcttccacacaatatttttgc |
19991160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University