View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21572_low_18 (Length: 231)
Name: NF21572_low_18
Description: NF21572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21572_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 18 - 133
Target Start/End: Complemental strand, 29651496 - 29651381
Alignment:
| Q |
18 |
ccatgttcaacatcatgtcgccgccttcaagttctgtttccattttcctttttgttctgctaaataggttttttgttcgtttgcttctattgcaggattg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29651496 |
ccatgttcaacatcatgtcgccgccttcaagttctgtttccattttcctttttgttctgctaaataggttttttgttcgtttgcttctattgcaggattg |
29651397 |
T |
|
| Q |
118 |
agaagaatgaaaccaa |
133 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
29651396 |
agaagaatgaaaccaa |
29651381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 125 - 214
Target Start/End: Complemental strand, 29650414 - 29650322
Alignment:
| Q |
125 |
tgaaaccaatgagtggccatgaagttgatggtaagtaagtttagttctgtttatagactgttatttagttatgta---tttaaaggttgctat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
29650414 |
tgaaaccaatgagtggccatgaagttgatggtaagtaagtttagttctgtttatagactgttattgagttatgtattttttaaaggttgctat |
29650322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University