View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21572_low_20 (Length: 225)
Name: NF21572_low_20
Description: NF21572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21572_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 38950281 - 38950072
Alignment:
| Q |
1 |
agtagtttctacattggcgatgtagattcaatactcgtagttcttattgtatagcaagtgtgagttaaaagttcgatgttgagtattgagatccataaac |
100 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38950281 |
agtagtttttacattggcggtgtagattcaatactcatagttcttattgtatagcaaatgtgagttaaaagttcgatgttgagtattgagatccataaac |
38950182 |
T |
 |
| Q |
101 |
tcaatatcttaaagttatgcattaagatatgatgtccaacttaattgtatgattgtttttgatcaaatgtggttgatctctcagactctccacatacccc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
38950181 |
tcaatatcttaaagttatgcattaagatatgatgtccaactcaattgtataattgtttttgatcaaatgtggttgatctctcatactccccacatacccc |
38950082 |
T |
 |
| Q |
201 |
caacaatttc |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
38950081 |
caacaatttc |
38950072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University