View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21572_low_21 (Length: 217)
Name: NF21572_low_21
Description: NF21572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21572_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 16 - 199
Target Start/End: Original strand, 38951016 - 38951199
Alignment:
| Q |
16 |
attattctattagtgtcaatggttgttagttgactcctttctcatgttaagtatatggtattaaattgtagcttttaatattatactagattttgttgca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38951016 |
attattctattagtgtcaatggttgttagttgactcctttctcatgttaagtatatggtattaaattgtagcttttaatattatactagattttgttgca |
38951115 |
T |
|
| Q |
116 |
taattggtgagagagatatttggtcttttgatttggatttacaatttcaaggcgttgaaaagtagtggattgaagtggtaaagt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38951116 |
taattggtgagagagatatttggtcttttgatttggatttacaatttcaaggcgttgaaaagtagtggattgaagtggtaaagt |
38951199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University