View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21572_low_6 (Length: 475)
Name: NF21572_low_6
Description: NF21572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21572_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 392; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 392; E-Value: 0
Query Start/End: Original strand, 1 - 460
Target Start/End: Complemental strand, 53453752 - 53453293
Alignment:
| Q |
1 |
aacggtaacgcaaccacgtcgtttgggtttattttaacttctggtaattcgttttcatcagcatttgttaaagcagaaaagttcacaacatgttcatctt |
100 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| | |||||||| |||||||| |
|
|
| T |
53453752 |
aacggtaacgcaactacatcgtttgggtttatttttacttctggtaattcgttttcatcagcatttgttaaaacagaaaaatccacaacattttcatctt |
53453653 |
T |
 |
| Q |
101 |
cctccggtgatgaatcaatgcacacgattttgatgtcgttgagttttgcgaaatcattgattttattgagatacgcggattgtgttatgatgagtttaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
53453652 |
cctccggtgatgaatcaatgcacacgattttgatgtcgatgagttttgcgaaatcgttgattttattgagatatacggattgtgttatgatgagtttaga |
53453553 |
T |
 |
| Q |
201 |
ttttgttgcggtggcttgtttagcgagctccgatgaggtgtagaagggatttgcggtggtgataaccgcgccacggaaggaggcaccgaggaaggtgaga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
53453552 |
ttttgttgcggtggcttgtttagcgagctccgatgaggtgtagaagggatttgcggtggtgataaccgcgccgcggaaggaggcaccgaggaaggtgagt |
53453453 |
T |
 |
| Q |
301 |
gcaaattgaggagagttacggaggacgatcatgatgacatcaccttgttggattccaagagtgtttagaccagaggcgaatttgcggacggtgaggtgga |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
53453452 |
gcaaattgaggagagttacggaggacgatcatgatgacatcaccttgttggattccaagagtgtttagaccggctgcgattttgcggacggtgaggtgga |
53453353 |
T |
 |
| Q |
401 |
cgtcggagtaggttagggtttcgccggtgtcgccgttgatgagacatggacggttgttga |
460 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53453352 |
cgtcggagtaggttagggtttcgccggtgtcgccgttgatgagacatggacggttgttga |
53453293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University