View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21573_high_8 (Length: 238)
Name: NF21573_high_8
Description: NF21573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21573_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 4058491 - 4058256
Alignment:
| Q |
1 |
cctgcttcttcttcacaatcagcacctgaaggtaaccgattcacatcgattcctcggagaattaaaggacgttcttcgattctgcatgtctccgaatccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4058491 |
cctgcttcttcttcacaatcagcacctgaaggtaaccgattcacatcgattcctcggagaattaaaggacgttcttcgattctgcatgtctccgaatccc |
4058392 |
T |
 |
| Q |
101 |
gatctgcatgtaaaataagatcgttacttaaattgaacaatcctatttaacatcaacacgttttagtgtcg-------------tgttaggaggaaatta |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
4058391 |
gatctgcatgtaaaataagatcgttacttaaattgaacaatcctatttaacatcaacatgttttagtgtcgtgtttggtgtacgtgttaggaggaaatta |
4058292 |
T |
 |
| Q |
188 |
attaaatgaaggaaggaaattataaaggaaactttt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
4058291 |
attaaatgaaggaaggaaattataaaggaaactttt |
4058256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University