View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21573_low_11 (Length: 231)
Name: NF21573_low_11
Description: NF21573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21573_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 32 - 173
Target Start/End: Complemental strand, 4058936 - 4058795
Alignment:
| Q |
32 |
acatgcactggatatgtgtttcgattttttaaatattgtcgactagtcaaatgaactaaccttgctctacgattttgaaaccaaacttcaacttgtctag |
131 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4058936 |
acatgcattgaatatgtgtttcgattttttaaatattgtcgactagtcaaatgaactaaccttgctctacgattttgaaaccaaacttcaacttgtctag |
4058837 |
T |
|
| Q |
132 |
cacgaagtcccaattgttttgcaagtgccaatttttgtttct |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4058836 |
cacgaagtcccaattgttttgcaagtgccaatttttgtttct |
4058795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 90 - 173
Target Start/End: Complemental strand, 23336215 - 23336132
Alignment:
| Q |
90 |
accttgctctacgattttgaaaccaaacttcaacttgtctagcacgaagtcccaattgttttgcaagtgccaatttttgtttct |
173 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||| | || || ||| ||| |||||||||||||| | |||||| |||| |
|
|
| T |
23336215 |
accttgctcttctattttgaaaccaaacttcaacttgacgaggactaagattcaactgttttgcaagtgcaagtttttgcttct |
23336132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 104 - 173
Target Start/End: Original strand, 41452219 - 41452288
Alignment:
| Q |
104 |
ttttgaaaccaaacttcaacttgtctagcacgaagtcccaattgttttgcaagtgccaatttttgtttct |
173 |
Q |
| |
|
||||||||||| ||||| |||||||| | |||||| || | ||| |||||||||||||| ||||| |||| |
|
|
| T |
41452219 |
ttttgaaaccagacttctacttgtcttggacgaagaccaagttgctttgcaagtgccaacttttgcttct |
41452288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University