View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21573_low_4 (Length: 389)
Name: NF21573_low_4
Description: NF21573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21573_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 55 - 344
Target Start/End: Complemental strand, 4752443 - 4752156
Alignment:
| Q |
55 |
agggatttggttgattgtggtgtgtgtgcgcgcgcgttataggtggtcctgctgttggagacatacgttctaggtgtttgaggttgtctgatcaaagtac |
154 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4752443 |
agggatttggttgattgtggtgtgtg--cgcgcgcgttataggtggtcctgctgttggagacatacgttctaggtgtttgaggttgtctgatcaaagtac |
4752346 |
T |
 |
| Q |
155 |
agcggaggctcttgcggttcgaaatttgcttggtcatcgtttaccacttgattctttgcaagctaaatcagaatggtaccatatttaaactctcttgctt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4752345 |
agcggaggctcttgcggttcgaaatttgcttggtcatcgtttaccacttgattctttgcaagctaaatcagaatggtaccatatttgaactctcttgctt |
4752246 |
T |
 |
| Q |
255 |
ttctttcaattattgcatatatagttatggtacaagtgattatgtataaggtgtttctataacaagagacaaaatgaattaaacctgttt |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4752245 |
ctctttcaattattgcatatatagttatggtacaagtgattatgtataaggtgtttctataacaagagacaaaatgaattaaaccggttt |
4752156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University