View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21574_high_13 (Length: 357)
Name: NF21574_high_13
Description: NF21574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21574_high_13 |
 |  |
|
| [»] scaffold0314 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0504 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 280; Significance: 1e-157; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 21 - 339
Target Start/End: Complemental strand, 5579852 - 5579527
Alignment:
| Q |
21 |
ctggctggtgctgcaaggttcttttctttcttttgcatgccctatttttataataattctactcgaatctctattccacggacacttatgattgaatgca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5579852 |
ctggctggtgctgcaaggttcttttctttcttttgcatgccctatttttataataattctactcgaatctctattccacggacacttatgattgaatgca |
5579753 |
T |
 |
| Q |
121 |
tgttctg-------acacgtgtcatgcctaacaccgacagaatgtcgacacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcg |
213 |
Q |
| |
|
||||||| |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5579752 |
tgttctggtgtctgacacgtattatgcctaacaccgacagaatgtcgacacttgtgactacattgaactatgtcattttctcaaaattttatcggtgtcg |
5579653 |
T |
 |
| Q |
214 |
acgtatttgtgtcagcatcgtatccagtatctgtgtatgtgttcgtgcatgatagactcgagtcgatctcatggaaacatctaatagtttatgattgttg |
313 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5579652 |
acgtattcgtgtcagcatcgtatccagtatctgtgtctgtgttcgtgcatgatagactcgagtcgatctcatggaaacatctaatagtttatgattgttg |
5579553 |
T |
 |
| Q |
314 |
atgatgaattggtcaggtaatctgtg |
339 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
5579552 |
atgatgaattggtcaggtaatctgtg |
5579527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 161 - 227
Target Start/End: Complemental strand, 10031621 - 10031555
Alignment:
| Q |
161 |
acacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcgacgtatttgtgtca |
227 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
10031621 |
acacttgtgattacattgaattatgtcattttctcaaaattttatcggtgtcaacgtgtttgtgtca |
10031555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 159 - 208
Target Start/End: Original strand, 6751888 - 6751937
Alignment:
| Q |
159 |
cgacacttgtgactacattgaactatgtcattttctcaaaattttatcga |
208 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6751888 |
cgacacttgtgattacattgaattatgtcattttctcaaaattttatcga |
6751937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 159 - 206
Target Start/End: Complemental strand, 19369870 - 19369823
Alignment:
| Q |
159 |
cgacacttgtgactacattgaactatgtcattttctcaaaattttatc |
206 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19369870 |
cgacacttgtgattacattgaattatgtcattttctcaaaattttatc |
19369823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 172 - 225
Target Start/End: Original strand, 2140500 - 2140553
Alignment:
| Q |
172 |
tacattgaactatgtcattttctcaaaattttatcgatgtcgacgtatttgtgt |
225 |
Q |
| |
|
||||||||| ||||||||||||||||| | ||||| ||||||| |||||||||| |
|
|
| T |
2140500 |
tacattgaattatgtcattttctcaaattattatcaatgtcgatgtatttgtgt |
2140553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 159 - 207
Target Start/End: Complemental strand, 22746010 - 22745962
Alignment:
| Q |
159 |
cgacacttgtgactacattgaactatgtcattttctcaaaattttatcg |
207 |
Q |
| |
|
|||||||||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
22746010 |
cgacacttgtgattacattgaaatataacattttctcaaaattttatcg |
22745962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 172 - 207
Target Start/End: Complemental strand, 29959215 - 29959180
Alignment:
| Q |
172 |
tacattgaactatgtcattttctcaaaattttatcg |
207 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29959215 |
tacattgaattatgtcattttctcaaaattttatcg |
29959180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 172 - 226
Target Start/End: Complemental strand, 17168934 - 17168880
Alignment:
| Q |
172 |
tacattgaactatgtcattttctcaaaattttatcgatgtcgacgtatttgtgtc |
226 |
Q |
| |
|
||||||||| ||||||||||| ||||| | ||||| |||||||||| |||||||| |
|
|
| T |
17168934 |
tacattgaattatgtcattttttcaaattattatcaatgtcgacgtgtttgtgtc |
17168880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0314 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0314
Description:
Target: scaffold0314; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 159 - 211
Target Start/End: Complemental strand, 9001 - 8949
Alignment:
| Q |
159 |
cgacacttgtgactacattgaactatgtcattttctcaaaattttatcgatgt |
211 |
Q |
| |
|
|||||||||||| ||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9001 |
cgacacttgtgattacgttgaattatgtcattttctcaaaattttatcgatgt |
8949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 9)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 160 - 228
Target Start/End: Original strand, 5937428 - 5937496
Alignment:
| Q |
160 |
gacacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcgacgtatttgtgtcag |
228 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||||| ||| ||||| | |||||||| |
|
|
| T |
5937428 |
gacacttgtgattacattgaattatgtcattttctcaaaattttatccgtgttgacgtgtctgtgtcag |
5937496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 160 - 217
Target Start/End: Original strand, 9050140 - 9050197
Alignment:
| Q |
160 |
gacacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcgacgt |
217 |
Q |
| |
|
||||| ||||| || |||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
9050140 |
gacacatgtgattatattgaactatgtcattttttcaaaattttatctatgtcgacgt |
9050197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 159 - 206
Target Start/End: Complemental strand, 1885626 - 1885579
Alignment:
| Q |
159 |
cgacacttgtgactacattgaactatgtcattttctcaaaattttatc |
206 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
1885626 |
cgacacttgtgattacattgaattatgtcattttttcaaaattttatc |
1885579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 160 - 205
Target Start/End: Original strand, 2144546 - 2144591
Alignment:
| Q |
160 |
gacacttgtgactacattgaactatgtcattttctcaaaattttat |
205 |
Q |
| |
|
||||| ||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
2144546 |
gacacgtgtgattacattgaattatgtcattttctcaaaattttat |
2144591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 159 - 217
Target Start/End: Original strand, 22801747 - 22801805
Alignment:
| Q |
159 |
cgacacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcgacgt |
217 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||| ||||||||||| |||| ||| ||||| |
|
|
| T |
22801747 |
cgacacttgtgattacagtgaattatgtcattatctcaaaatttgatcggtgttgacgt |
22801805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 217
Target Start/End: Original strand, 9037724 - 9037781
Alignment:
| Q |
160 |
gacacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcgacgt |
217 |
Q |
| |
|
||||| ||||| || |||||||||| ||||||| ||||||||||||| |||| ||||| |
|
|
| T |
9037724 |
gacacatgtgattatattgaactatatcattttttcaaaattttatctatgttgacgt |
9037781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 161 - 206
Target Start/End: Original strand, 48964070 - 48964115
Alignment:
| Q |
161 |
acacttgtgactacattgaactatgtcattttctcaaaattttatc |
206 |
Q |
| |
|
|||||||||| || |||||| ||||||||||||||| ||||||||| |
|
|
| T |
48964070 |
acacttgtgattaaattgaattatgtcattttctcacaattttatc |
48964115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 166 - 202
Target Start/End: Original strand, 2143866 - 2143902
Alignment:
| Q |
166 |
tgtgactacattgaactatgtcattttctcaaaattt |
202 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
2143866 |
tgtgattacattgaattatgtcattttctcaaaattt |
2143902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 176 - 212
Target Start/End: Complemental strand, 31377036 - 31377000
Alignment:
| Q |
176 |
ttgaactatgtcattttctcaaaattttatcgatgtc |
212 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
31377036 |
ttgaattatgtcattttctcaaaattttattgatgtc |
31377000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 159 - 206
Target Start/End: Original strand, 43586011 - 43586058
Alignment:
| Q |
159 |
cgacacttgtgactacattgaactatgtcattttctcaaaattttatc |
206 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43586011 |
cgacacttgtgattacattgaattatgtcattttctcaaaattttatc |
43586058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 159 - 207
Target Start/End: Original strand, 13501084 - 13501132
Alignment:
| Q |
159 |
cgacacttgtgactacattgaactatgtcattttctcaaaattttatcg |
207 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
13501084 |
cgacacttgtgattacattgaattatgtcattttcttaaaattttatcg |
13501132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 160 - 210
Target Start/End: Original strand, 14450802 - 14450852
Alignment:
| Q |
160 |
gacacttgtgactacattgaactatgtcattttctcaaaattttatcgatg |
210 |
Q |
| |
|
||||||||||| ||||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
14450802 |
gacacttgtgattacattgaattatgtgattttctcaaaattttgtcgatg |
14450852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 159 - 220
Target Start/End: Original strand, 10535765 - 10535826
Alignment:
| Q |
159 |
cgacacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcgacgtatt |
220 |
Q |
| |
|
|||||||| ||| |||| |||| ||||||||||||||||| | |||||| ||||| |||||| |
|
|
| T |
10535765 |
cgacacttatgattacactgaattatgtcattttctcaaattattatcggtgtcggcgtatt |
10535826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 213
Target Start/End: Original strand, 18512149 - 18512202
Alignment:
| Q |
160 |
gacacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcg |
213 |
Q |
| |
|
||||| ||||| ||||||||| ||| | |||||||||||||||||||| ||||| |
|
|
| T |
18512149 |
gacacatgtgattacattgaattatattattttctcaaaattttatcggtgtcg |
18512202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 161 - 202
Target Start/End: Complemental strand, 24067304 - 24067263
Alignment:
| Q |
161 |
acacttgtgactacattgaactatgtcattttctcaaaattt |
202 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||| |||||||| |
|
|
| T |
24067304 |
acacttgtgattacattgaattatgtcattttcacaaaattt |
24067263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 161 - 217
Target Start/End: Complemental strand, 42665659 - 42665603
Alignment:
| Q |
161 |
acacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcgacgt |
217 |
Q |
| |
|
|||| ||||| ||||||||| ||||||| || |||||||||||||||| ||||||| |
|
|
| T |
42665659 |
acacatgtgattacattgaatcatgtcatcttttcaaaattttatcgatatcgacgt |
42665603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 8)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 159 - 217
Target Start/End: Original strand, 26915246 - 26915304
Alignment:
| Q |
159 |
cgacacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcgacgt |
217 |
Q |
| |
|
|||||||||||| |||||| || ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26915246 |
cgacacttgtgattacattaaattatgtcattttctcaaaattttatccgtgtcgacgt |
26915304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 160 - 217
Target Start/End: Complemental strand, 42874574 - 42874517
Alignment:
| Q |
160 |
gacacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcgacgt |
217 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||| ||| || ||||||||| |
|
|
| T |
42874574 |
gacacttgtgattacattgaattatgtcattttctcaaaatgttaacggtgtcgacgt |
42874517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 159 - 215
Target Start/End: Original strand, 24295143 - 24295199
Alignment:
| Q |
159 |
cgacacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcgac |
215 |
Q |
| |
|
|||||||||||| |||||| || | ||||||||||||| |||||||||||||||||| |
|
|
| T |
24295143 |
cgacacttgtgattacattaaattgtgtcattttctcacaattttatcgatgtcgac |
24295199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 158 - 202
Target Start/End: Complemental strand, 31119141 - 31119097
Alignment:
| Q |
158 |
tcgacacttgtgactacattgaactatgtcattttctcaaaattt |
202 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
31119141 |
tcgacacttgtgattacattgaattatgtcattttctcaaaattt |
31119097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 161 - 207
Target Start/End: Complemental strand, 27733898 - 27733852
Alignment:
| Q |
161 |
acacttgtgactacattgaactatgtcattttctcaaaattttatcg |
207 |
Q |
| |
|
|||||||||| ||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
27733898 |
acacttgtgattacattgaattatatcattttctcaaaattttatcg |
27733852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 158 - 213
Target Start/End: Original strand, 34073983 - 34074038
Alignment:
| Q |
158 |
tcgacacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcg |
213 |
Q |
| |
|
||||||||| ||| |||||| || ||||||||||| |||||||||||||| ||||| |
|
|
| T |
34073983 |
tcgacacttatgattacattaaattatgtcattttttcaaaattttatcggtgtcg |
34074038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 167 - 217
Target Start/End: Original strand, 34739075 - 34739125
Alignment:
| Q |
167 |
gtgactacattgaactatgtcattttctcaaaattttatcgatgtcgacgt |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | | ||||||||||| |||| |
|
|
| T |
34739075 |
gtgactacattgaattatgtcattttctcatattattatcgatgtcaacgt |
34739125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 160 - 228
Target Start/End: Original strand, 10497823 - 10497891
Alignment:
| Q |
160 |
gacacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcgacgtatttgtgtcag |
228 |
Q |
| |
|
||||||||||| ||||| || ||||| ||||||||||||||||||| ||||| ||| | |||||||| |
|
|
| T |
10497823 |
gacacttgtgattacatcaaattatgttattttctcaaaattttatccgtgtcggcgtgtctgtgtcag |
10497891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 159 - 217
Target Start/End: Original strand, 49179721 - 49179779
Alignment:
| Q |
159 |
cgacacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcgacgt |
217 |
Q |
| |
|
|||||||||||| ||||| ||| ||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
49179721 |
cgacacttgtgattacatcgaattatgtcactttctcaaaattttatcggtgtcgacgt |
49179779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 159 - 207
Target Start/End: Original strand, 14338489 - 14338537
Alignment:
| Q |
159 |
cgacacttgtgactacattgaactatgtcattttctcaaaattttatcg |
207 |
Q |
| |
|
||||| |||||| ||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
14338489 |
cgacatttgtgattacattgaattatgtcattttttcaaaattttatcg |
14338537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 159 - 217
Target Start/End: Original strand, 40686764 - 40686822
Alignment:
| Q |
159 |
cgacacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcgacgt |
217 |
Q |
| |
|
|||||||| ||| ||||||||| ||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
40686764 |
cgacacttatgattacattgaattatatcattttatcaaaattttatcgatgtcgacgt |
40686822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 226
Target Start/End: Original strand, 24462280 - 24462343
Alignment:
| Q |
163 |
acttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcgacgtatttgtgtc |
226 |
Q |
| |
|
|||||||| ||||||||| ||||||||||| ||||||||| ||| ||||||||||| |||||| |
|
|
| T |
24462280 |
acttgtgattacattgaattatgtcattttttcaaaatttgatcagtgtcgacgtatctgtgtc |
24462343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 166 - 215
Target Start/End: Complemental strand, 14332454 - 14332406
Alignment:
| Q |
166 |
tgtgactacattgaactatgtcattttctcaaaattttatcgatgtcgac |
215 |
Q |
| |
|
||||| ||||||||| |||||||||||||| ||||||||||| ||||||| |
|
|
| T |
14332454 |
tgtgattacattgaattatgtcattttctc-aaattttatcggtgtcgac |
14332406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 161 - 202
Target Start/End: Original strand, 18946042 - 18946083
Alignment:
| Q |
161 |
acacttgtgactacattgaactatgtcattttctcaaaattt |
202 |
Q |
| |
|
||||| |||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
18946042 |
acactcgtgattacattgaattatgtcattttctcaaaattt |
18946083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 217
Target Start/End: Complemental strand, 40176655 - 40176598
Alignment:
| Q |
160 |
gacacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcgacgt |
217 |
Q |
| |
|
||||| ||||| ||||||||| | ||||||||||||||||||||||| ||| ||||| |
|
|
| T |
40176655 |
gacacatgtgattacattgaatgaagtcattttctcaaaattttatcggtgttgacgt |
40176598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 160 - 204
Target Start/End: Original strand, 46748915 - 46748959
Alignment:
| Q |
160 |
gacacttgtgactacattgaactatgtcattttctcaaaatttta |
204 |
Q |
| |
|
|||| |||||| |||||||||||||||| |||| ||||||||||| |
|
|
| T |
46748915 |
gacatttgtgattacattgaactatgtcgttttttcaaaatttta |
46748959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 161 - 206
Target Start/End: Complemental strand, 13307928 - 13307883
Alignment:
| Q |
161 |
acacttgtgactacattgaactatgtcattttctcaaaattttatc |
206 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13307928 |
acacttgtgattacattgaattatgtcattttctcaaaattttatc |
13307883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 161 - 212
Target Start/End: Complemental strand, 44362717 - 44362666
Alignment:
| Q |
161 |
acacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtc |
212 |
Q |
| |
|
|||||||||| |||||| || |||||||||||||||||||||||||| |||| |
|
|
| T |
44362717 |
acacttgtgattacattaaattatgtcattttctcaaaattttatcggtgtc |
44362666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 159 - 217
Target Start/End: Complemental strand, 37496757 - 37496699
Alignment:
| Q |
159 |
cgacacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcgacgt |
217 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||| |||||| |||| |||| |
|
|
| T |
37496757 |
cgacacttgtgattacattgaattatgtcattttctcaaaaaattatcggtgtcaacgt |
37496699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 159 - 205
Target Start/End: Complemental strand, 13117482 - 13117436
Alignment:
| Q |
159 |
cgacacttgtgactacattgaactatgtcattttctcaaaattttat |
205 |
Q |
| |
|
|||||||||||| ||||||||| | |||||||||||| ||||||||| |
|
|
| T |
13117482 |
cgacacttgtgattacattgaattttgtcattttctccaaattttat |
13117436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 172 - 206
Target Start/End: Complemental strand, 28663532 - 28663498
Alignment:
| Q |
172 |
tacattgaactatgtcattttctcaaaattttatc |
206 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28663532 |
tacattgaattatgtcattttctcaaaattttatc |
28663498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 172 - 213
Target Start/End: Complemental strand, 49887796 - 49887755
Alignment:
| Q |
172 |
tacattgaactatgtcattttctcaaaattttatcgatgtcg |
213 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
49887796 |
tacattgaattatgtcatttcttcaaaattttatcgatgtcg |
49887755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 161 - 217
Target Start/End: Original strand, 18116 - 18172
Alignment:
| Q |
161 |
acacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcgacgt |
217 |
Q |
| |
|
||||||| || ||||||||| ||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
18116 |
acacttgcgattacattgaattatgttattttctcaaaattttatcggtgtcgacgt |
18172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000008; HSPs: 6)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 163 - 215
Target Start/End: Original strand, 30080511 - 30080563
Alignment:
| Q |
163 |
acttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcgac |
215 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
30080511 |
acttgtgattacattgaattatgtcattttctcaaaattttatcagtgtcgac |
30080563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 158 - 206
Target Start/End: Original strand, 21319950 - 21319998
Alignment:
| Q |
158 |
tcgacacttgtgactacattgaactatgtcattttctcaaaattttatc |
206 |
Q |
| |
|
||||||||||||| ||||||||| ||| ||||||| ||||||||||||| |
|
|
| T |
21319950 |
tcgacacttgtgattacattgaattatatcattttttcaaaattttatc |
21319998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 182 - 217
Target Start/End: Complemental strand, 309188 - 309153
Alignment:
| Q |
182 |
tatgtcattttctcaaaattttatcgatgtcgacgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
309188 |
tatgtcattttctcaaaattttatcggtgtcgacgt |
309153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 159 - 228
Target Start/End: Original strand, 19167582 - 19167652
Alignment:
| Q |
159 |
cgacacttgtgactacattgaactatgtca-ttttctcaaaattttatcgatgtcgacgtatttgtgtcag |
228 |
Q |
| |
|
|||||||||||| ||||||||| | ||||| |||| |||||||||||||| |||| |||| | |||||||| |
|
|
| T |
19167582 |
cgacacttgtgattacattgaattgtgtcatttttttcaaaattttatcggtgtcaacgtgtctgtgtcag |
19167652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 159 - 217
Target Start/End: Original strand, 26205766 - 26205824
Alignment:
| Q |
159 |
cgacacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtcgacgt |
217 |
Q |
| |
|
|||||| | ||| |||| |||| |||||||||||||||||||||||||| | ||||||| |
|
|
| T |
26205766 |
cgacacctatgattacactgaattatgtcattttctcaaaattttatcggtatcgacgt |
26205824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 172 - 224
Target Start/End: Original strand, 11596474 - 11596526
Alignment:
| Q |
172 |
tacattgaactatgtcattttctcaaaattttatcgatgtcgacgtatttgtg |
224 |
Q |
| |
|
||||||||| ||||||||||||||||| | |||||| | ||||||| |||||| |
|
|
| T |
11596474 |
tacattgaattatgtcattttctcaaattattatcggtatcgacgtgtttgtg |
11596526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0504 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0504
Description:
Target: scaffold0504; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 161 - 212
Target Start/End: Original strand, 8705 - 8756
Alignment:
| Q |
161 |
acacttgtgactacattgaactatgtcattttctcaaaattttatcgatgtc |
212 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
8705 |
acacttgtggttacattgaatcatgtcattttctcaaaattttatccatgtc |
8756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University