View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21574_low_10 (Length: 364)
Name: NF21574_low_10
Description: NF21574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21574_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 8e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 18 - 168
Target Start/End: Original strand, 34637627 - 34637777
Alignment:
| Q |
18 |
ggaagaacgaaaaagaagtaaagagttggttattggggataatgattttcttagcactttgttatctttacctaaagaggaaagattaggtgattccgat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34637627 |
ggaagaacgaaaaagaagtaaagagttggttattggggataatgattttcttagcactttgttatctttacctaaagaggaaagattaggtgattccgat |
34637726 |
T |
|
| Q |
118 |
atggtggcaattctatgggtaagtttctaattcttctctcatcatcaagtg |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34637727 |
atggtggcaattctatgggtaagtttctaattcttctctcatcatcaagtg |
34637777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 236 - 364
Target Start/End: Original strand, 34637839 - 34637967
Alignment:
| Q |
236 |
gccatgcatgaatatgtttgctattttgtgtaggaaatgatatttcgaggaacagacacagttgctatactccttgaatggaccatggcaaggatggttt |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34637839 |
gccatgcatgaatatgtttgctattttgtgtaggaaatgatatttcgaggaacagacacagttgctatactccttgaatggaccatggcaaggatggttt |
34637938 |
T |
|
| Q |
336 |
tacatcaagacatacaaatgaaagcccgt |
364 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34637939 |
tacatcaagacatacaaatgaaagcccgt |
34637967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University