View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21574_low_12 (Length: 359)
Name: NF21574_low_12
Description: NF21574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21574_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 14 - 182
Target Start/End: Original strand, 48956975 - 48957143
Alignment:
| Q |
14 |
ttctaggatttggtgtctttgaggctgttggtggtggactcaacacatggttaaggacaggaaagctatttccaggtccacatttatttgcaggagcagg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48956975 |
ttctaggatttggtgtctttgaggctgttggtggtggactcaacacatggttaaggacaggaaagctatttccaggtccacatttatttgcaggagcagg |
48957074 |
T |
 |
| Q |
114 |
taattaaacactaaattcacatttgtttcaagagcaaagtacacataccttccttccccttgagctatt |
182 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
48957075 |
taattaaacactaaattcgcatttttttcaagagcaaagtacacatacctcccttccccttgagctatt |
48957143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 222 - 342
Target Start/End: Original strand, 48957157 - 48957277
Alignment:
| Q |
222 |
aaatgcacttacctccatttacagttaacagcttttcacttctgttaaatttatatatcaatgtcttcgtcccaatgtgccactgtcaccattgtccgta |
321 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48957157 |
aaatgcacttacctccatttacaggtaacagcttttcacttctgttaaatttatatatcaatgtcttcgtcccaatgtgccactgtcaccattgtccgta |
48957256 |
T |
 |
| Q |
322 |
cttaatctcgaaggagcttcc |
342 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
48957257 |
cttaatctcgaaggagcttcc |
48957277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University