View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21574_low_20 (Length: 239)

Name: NF21574_low_20
Description: NF21574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21574_low_20
NF21574_low_20
[»] chr8 (1 HSPs)
chr8 (29-96)||(38091688-38091755)
[»] chr2 (1 HSPs)
chr2 (118-197)||(8077174-8077253)


Alignment Details
Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 29 - 96
Target Start/End: Original strand, 38091688 - 38091755
Alignment:
29 attatactaaaccacatataacaatggggattaaaaacaattgtttttgaattcgtaaggattgaact 96  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38091688 attatactaaaccacatataacaatggggattaaaaacaattgtttttgaattcgtaaggattgaact 38091755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 118 - 197
Target Start/End: Complemental strand, 8077253 - 8077174
Alignment:
118 cctaagtgggtaatacaacatgaaaacaaaagtagtataacaaacaaattgaattgagatctactaatgagcctaatgct 197  Q
    |||||| |||||||| ||||||||||||||||| ||||||||||||||| | ||||||||  | ||||||||||||||||    
8077253 cctaagcgggtaataaaacatgaaaacaaaagtggtataacaaacaaatcggattgagattcagtaatgagcctaatgct 8077174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University