View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21574_low_20 (Length: 239)
Name: NF21574_low_20
Description: NF21574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21574_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 29 - 96
Target Start/End: Original strand, 38091688 - 38091755
Alignment:
| Q |
29 |
attatactaaaccacatataacaatggggattaaaaacaattgtttttgaattcgtaaggattgaact |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38091688 |
attatactaaaccacatataacaatggggattaaaaacaattgtttttgaattcgtaaggattgaact |
38091755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 118 - 197
Target Start/End: Complemental strand, 8077253 - 8077174
Alignment:
| Q |
118 |
cctaagtgggtaatacaacatgaaaacaaaagtagtataacaaacaaattgaattgagatctactaatgagcctaatgct |
197 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||| ||||||||||||||| | |||||||| | |||||||||||||||| |
|
|
| T |
8077253 |
cctaagcgggtaataaaacatgaaaacaaaagtggtataacaaacaaatcggattgagattcagtaatgagcctaatgct |
8077174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University