View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21574_low_24 (Length: 201)

Name: NF21574_low_24
Description: NF21574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21574_low_24
NF21574_low_24
[»] chr7 (1 HSPs)
chr7 (49-107)||(25286374-25286432)


Alignment Details
Target: chr7 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 49 - 107
Target Start/End: Complemental strand, 25286432 - 25286374
Alignment:
49 attgattctgttattattgattattgatgatttcaatgcatgtgatgttagctacaata 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25286432 attgattctgttattattgattattgatgatttcaatgcatgtgatgttagctacaata 25286374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University