View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21574_low_8 (Length: 382)
Name: NF21574_low_8
Description: NF21574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21574_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 1 - 363
Target Start/End: Original strand, 22561469 - 22561831
Alignment:
| Q |
1 |
agcagagaaaggtttatatagcaataagcttagtacaatggttgtatgaagaaggatgtaaggtgaagggggaggaaaaatgagaggcaagaaagagtat |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22561469 |
agcaaagaaaggtttatatagcaataagcttagtacaatggttgtatgaagaaggatgtaaggtgaagggggaggaaaaatgagaggcaagaaagagtat |
22561568 |
T |
 |
| Q |
101 |
ttatagatggaagaattattggttatgtggtagagatattgggttacaatattacattaaattattatttaatgtgaccaatgaagttcacacaatgatt |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22561569 |
ttatagatggaagaatgattggttatgtggtagagatattgggttacaatattacattaaattattatttaatgtgaccaatgaagttcacacaatgatt |
22561668 |
T |
 |
| Q |
201 |
attttgannnnnnnnnatctaggcaagatagtgacaccaaaatttaaatttgtcacaagnnnnnnnnnnnnnnnnngctttcacattggatagaaagaaa |
300 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22561669 |
attttgatttttttttatctaggcaagatagtgacaccaaaatttaaatttgtcacaagtttttttattttgttttgctttcacattggatagaaagaaa |
22561768 |
T |
 |
| Q |
301 |
caagtctagttcacacatactagtgtattaatttacaatctacctctacggtgtgtagttgct |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22561769 |
caagtctagttcacacatactagtgtattaatttacaatctacctctacggtgtgtagttgct |
22561831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University