View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21575_low_15 (Length: 268)
Name: NF21575_low_15
Description: NF21575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21575_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 7 - 261
Target Start/End: Original strand, 5390503 - 5390758
Alignment:
| Q |
7 |
gtatgaacctaactataaatcaaacctcaaactaaacatattgagaaatgtgagaaacatttgctttctaacactctttttaacactcactatcttatcg |
106 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| ||| | ||||| ||| ||||||||||||| |||||||| |
|
|
| T |
5390503 |
gtatgaacctaactatacatcaaacctcaaactaaacatattgagaaatgctagaaacattcgctgtttaacattctctttaacactcactctcttatcg |
5390602 |
T |
 |
| Q |
107 |
agggaactcatgtgaatcataccacttt--gtgatacccaattctaaagtgtgagacccatgtgaatttgatccaataagagagtaaatgttagagatga |
204 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||| ||||||||||||||||||||||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
5390603 |
-gggaactcatgtgaatcacaccactttaggtgatactcaattctaaagtgtgagacccatatgagtttgatccaatgagagagtaaatgttagagatga |
5390701 |
T |
 |
| Q |
205 |
cattagaaaaaaggtgctcagatcatacctcaaatatagttagtggattcttttacg |
261 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
5390702 |
cattagaaaaaaggtgctcagatcattcctcaaatatagttagtggatacttttacg |
5390758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University