View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21575_low_16 (Length: 263)
Name: NF21575_low_16
Description: NF21575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21575_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 155
Target Start/End: Original strand, 40963753 - 40963907
Alignment:
| Q |
1 |
atgtgtctttaacagattttgatttgtcatgtttaacatcttgcaagccacaggtatcttaggcaagaaaattagataacgtggttttagcaatatttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40963753 |
atgtgtctttaacagattttgatttgtcatgtttaacatcttgcaagccacaggtatcttaggcaagaaaattagataacgtggttttagcaatatttta |
40963852 |
T |
 |
| Q |
101 |
actaagaccactgaacagtttcactatgcagcttataattccagctaatgaggat |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40963853 |
actaagaccactgaacagtttcactatgcagcttataattccagctaatgaggat |
40963907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 186 - 245
Target Start/End: Original strand, 40963938 - 40963997
Alignment:
| Q |
186 |
ggacaacagaaaactcaacaaattccaacgtttatggcggaaccaatgagagcgtccaat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40963938 |
ggacaacagaaaactcaacaaattccaacgtttatggcggaaccaatgagagcgtccaat |
40963997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 22799329 - 22799387
Alignment:
| Q |
1 |
atgtgtctttaacagattttgatttgtcatgtttaacatcttgcaagccacaggtatct |
59 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
22799329 |
atgtgtctctaacagattttgatttgtcctgtttaacatcttgcaaaccacaggtatct |
22799387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 62
Target Start/End: Original strand, 19591938 - 19591987
Alignment:
| Q |
12 |
acagattttgatttgtcatgtttaacatcttgcaagccacaggtatcttag |
62 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||| |||||||||| |||| |
|
|
| T |
19591938 |
acagatttt-atttggcatgtttaacatcttgcaaaccacaggtattttag |
19591987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University