View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21575_low_8 (Length: 387)
Name: NF21575_low_8
Description: NF21575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21575_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 2e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 19 - 251
Target Start/End: Original strand, 50453369 - 50453607
Alignment:
| Q |
19 |
ataaagacgtacttcttgatcgatcgattcataaatgcattctcactcataatttttaatgctaggtacagtttttacttatataaactctaaataaaaa |
118 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50453369 |
ataaagacgtacttattgatcgatcgattcataaatgcattctcactcataatttttaatgctaggtacagtttttacttatataaactctaaataaaaa |
50453468 |
T |
|
| Q |
119 |
gaagttaaccttttttggtgatacatnnnnnnnnnggaattaattaatggtcgatctat-------atatatccttgatctagaccagttatgttcatta |
211 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
50453469 |
gaagttaaccttttttggtgatacat-aaaaaaaagaaattaattaatggtcgatctatatatatgatatatccttgatctagaccagttatgttcatta |
50453567 |
T |
|
| Q |
212 |
atattcttaccaacttggactgaagaaacaggcttgttaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50453568 |
atattcttaccaacttggactgaagaaacaggcttgttaa |
50453607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University