View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21576_low_5 (Length: 230)
Name: NF21576_low_5
Description: NF21576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21576_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 18715693 - 18715782
Alignment:
| Q |
1 |
tatgtaaatatagccttaaattatcatatgatataaatcatatcatatgataaaatatttatctctaaagtgccataatcccagttgaaa |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
18715693 |
tatgtaaatatagccttaaattatcatatgatataaatcatatcatatgataaagtattaatctctaaagtgccataatcccagttgaaa |
18715782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 94 - 161
Target Start/End: Complemental strand, 18715664 - 18715596
Alignment:
| Q |
94 |
aaaccaaaaggaatttttgatcggaaaaa-tacaaagattttgaatttatgaaacatagtaataaattg |
161 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
18715664 |
aaaccaaaaggaatttttgatcggaaaaaatacagagattttgaatttgtgaaacatagtaataaattg |
18715596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University