View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21577_high_12 (Length: 256)
Name: NF21577_high_12
Description: NF21577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21577_high_12 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 16 - 256
Target Start/End: Original strand, 40380853 - 40381095
Alignment:
| Q |
16 |
cttttgatcaaactcagatggataaacttactcttattcttgatcctactgatgagtttgtgtggaatcctgatacttgcaacttggtttattcttactt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40380853 |
cttttgatcaaactcagatggataaacttactcttattcttgatcctactgatgagtttgtgtggaatcctgatacttgcaacttggtttattcttactt |
40380952 |
T |
 |
| Q |
116 |
tcaggagcttgtggatcactatgaggtagtttccttaaacataatcaa--atatacaatagtttttgtcttagaatagtttcatatatactgaattcaca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40380953 |
tcaggagcttgtggatcactatgaggtagtttccttaaacatagtcaaatatatacaatagtttttgtcttagaatagtttcatatatactgaattcaca |
40381052 |
T |
 |
| Q |
214 |
tatactataattcaagactagcatgtaggcttctgcttagcaa |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40381053 |
tatactataattcaagactagcatgtaggcttctgcttagcaa |
40381095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University