View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2157_high_6 (Length: 368)
Name: NF2157_high_6
Description: NF2157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2157_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 13 - 196
Target Start/End: Complemental strand, 1331352 - 1331175
Alignment:
| Q |
13 |
atcaacaaaattttcaacatgagtaataacaagtgttgcacccgcgcttcaaaagccttggaggatgctatgccgtatgtattctccttgtcaacatatt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1331352 |
atcaacaaaattttcaacatgagtaataacaagtg--------gcacttcaaaagccttggaggatgctatgccgtatgcattctccttgtcaacatatt |
1331261 |
T |
|
| Q |
113 |
tatgaattgttttctttgaaacatatgcggg--nnnnnnnaccacgatctacattttccacaaccttccgagggattaaccaacga |
196 |
Q |
| |
|
|||||||||||||||| ||||||||||| || |||| |||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
1331260 |
tatgaattgttttcttcgaaacatatgcaggtttttttttaccatgatctacattttccacaatcttccgagggatcaaccaacga |
1331175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University