View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2157_low_9 (Length: 307)
Name: NF2157_low_9
Description: NF2157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2157_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 67 - 199
Target Start/End: Original strand, 31828014 - 31828146
Alignment:
| Q |
67 |
taagagtgtttttgatttgttctgcattgtttcaaaaatggtgtgtgaccatctttgagtaatagaggatcaccaccaccatcaaaactgttatgtctct |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31828014 |
taagagtgtttttgatttgttctgcattgtttcaaaaatggtgtgtgaccatctttgagtaatagaggatcaccaccaccatcaaaactgttatgtctct |
31828113 |
T |
 |
| Q |
167 |
atctctttgagtaaacacataaaaatcagaacc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31828114 |
atctctttgagtaaacacataaaaatcagaacc |
31828146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 241 - 299
Target Start/End: Original strand, 31828180 - 31828238
Alignment:
| Q |
241 |
attcaacagaaaaaacccgtattataagggttgtttttattacttgtactttcatctca |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31828180 |
attcaacagaaaaaacccgtattataagggttgtttttattacttgtactttcatctca |
31828238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University