View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21580_high_33 (Length: 340)
Name: NF21580_high_33
Description: NF21580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21580_high_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 37632156 - 37632361
Alignment:
| Q |
1 |
cggcggacgatcttgccggtgaaccatgagccgcggaaaccgtcgtcgtcggagctgatttcgactaaggtgccgggtttgaagaattcagaggcggcgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37632156 |
cggcggacgatcttgccggtgaaccatgagccgcggaaaccgtcgtcgtcggagctgatttcgactaaggtgccgggtttgaagaattcagaggcggcgg |
37632255 |
T |
|
| Q |
101 |
aggaagagcgggtttgggatttgggtgccattggattgtgggattagggtttgtttcacaattgcagaaatggaaaagaagaagagtgaagtgtgaatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37632256 |
aggaagagcgggtttgggatttgggtgccattggattgtgggattagggtttgtttcacaattgcagaaatggaaaagaagaagagtgaagtgtgaatgg |
37632355 |
T |
|
| Q |
201 |
gtagga |
206 |
Q |
| |
|
|||||| |
|
|
| T |
37632356 |
gtagga |
37632361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 225 - 331
Target Start/End: Original strand, 37632386 - 37632492
Alignment:
| Q |
225 |
ctttgtatagtgttgtttagcgggaattaagaatgtgttcatggctttattatgctatcttaatttcattttcaaatctactgttactaatctacccttg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37632386 |
ctttgtatagtgttgtttagcgggaattaagaatgtgttcatggctttattatgctatcttaatttcattttcaaatctactgttactaatctacccttg |
37632485 |
T |
|
| Q |
325 |
ttttcat |
331 |
Q |
| |
|
||||||| |
|
|
| T |
37632486 |
ttttcat |
37632492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University