View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21580_high_52 (Length: 240)
Name: NF21580_high_52
Description: NF21580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21580_high_52 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 178
Target Start/End: Original strand, 30810064 - 30810241
Alignment:
| Q |
1 |
tggcttgccatgactgcatggaaccgagctgcagtgccagtgcggttgggtcagattgaaatgggaaagaaatggatgaatatcggcttcgacattgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30810064 |
tggcttgccatgactgcatggaaccgagctgcggtgccagtgcggttgggtcagattgaaatgggaaagaaatggatgaatatcggcttcgacattgcaa |
30810163 |
T |
 |
| Q |
101 |
aacatgtttcaggcatggaagtttacaaagtatgcatggaagatgttcttagcaatttggagaaaaaactttgatttg |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30810164 |
aacatgtttcaggcatggaagtttacaaagcatgcatggaagatgttcttagcaatttggagaaaaaactttgatttg |
30810241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 179 - 225
Target Start/End: Original strand, 30810276 - 30810322
Alignment:
| Q |
179 |
gaaatagaacccatgcattttgtacaggacagaagtttagttcatgt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30810276 |
gaaatagaacccatgcattttgtacaggacagaagtttagttcatgt |
30810322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University