View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21580_high_61 (Length: 216)

Name: NF21580_high_61
Description: NF21580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21580_high_61
NF21580_high_61
[»] chr4 (2 HSPs)
chr4 (132-197)||(45331531-45331596)
chr4 (22-66)||(45330475-45330518)


Alignment Details
Target: chr4 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 132 - 197
Target Start/End: Original strand, 45331531 - 45331596
Alignment:
132 tgacattccatcattttgtttttgcaaattgacataatgattacaccttatttaaggattactagt 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45331531 tgacattccatcattttgtttttgcaaattgacataatgattacaccttatttaaggattactagt 45331596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 22 - 66
Target Start/End: Original strand, 45330475 - 45330518
Alignment:
22 gaaacaggagggaagaaatcgcaacttcacgttagaaattaggtt 66  Q
    |||||||||||||||||||||||| ||||||||||||||||||||    
45330475 gaaacaggagggaagaaatcgcaa-ttcacgttagaaattaggtt 45330518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University