View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21580_low_19 (Length: 471)
Name: NF21580_low_19
Description: NF21580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21580_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 358; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 54 - 452
Target Start/End: Complemental strand, 45037938 - 45037541
Alignment:
| Q |
54 |
gctgaaatatagcaccaaccatttcccctggtcttgnnnnnnnttctagaacggttgcacctaaacttttttactcacttccataataatttccatcgtt |
153 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45037938 |
gctgaaatatagcaccaaccatttccccttgtcttgaaaaaaattcttgaacggttgcacctaaacttttt-actcacttccataataatttccatcgtt |
45037840 |
T |
 |
| Q |
154 |
attccttacttcattttttatgtttttgcttccattgcacgaatgaatggtcaccaaaaaacagctcagtttaagctgctgaaggtgctgtgacatattg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45037839 |
attccttacttcattttttatgtttttgcttccattgcacgaatgaatggtcaccaaaaaacagctcagtttaagctgctgaaggtgctgtgacatattg |
45037740 |
T |
 |
| Q |
254 |
aacacgacctacctcagacaatgcttgtacgaatggctcaatttcaacaccattcgtttgtacttcaccacttccactcaaattcttgttgtaatcaaga |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45037739 |
aacacgacctacctcagacaatgcttgtacgaatggctcaatttcaaaaccattcgtttgtacttcaccacttccactcaaattcttgttgtaatcaaga |
45037640 |
T |
 |
| Q |
354 |
gatgaatcattgtaaatatcccaccatttcttgactagcattcttatatcctccctttgcatgttttcttccttccctgtgtatctccaaggctttgat |
452 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45037639 |
gatgaatcattgtaaatatcccaccatttcttgactagcattcttatatcctccctttgcatgttttcttccttccctgtgtatctccaaggctttgat |
45037541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University