View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21580_low_39 (Length: 298)
Name: NF21580_low_39
Description: NF21580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21580_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 25 - 282
Target Start/End: Complemental strand, 40213568 - 40213311
Alignment:
| Q |
25 |
tcaaaattggtactctgcaaaataggtatactacataactgcatctggtagatgtttatacattcagatagctttggatgcacggttccgcccgtgattg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40213568 |
tcaaaattggtactctgcaaaataggtatactacataactgcatttggtagatgtttatacattcagatagctttggatgcacggttccgttcgtgattg |
40213469 |
T |
 |
| Q |
125 |
caatcacaagaggctgctactctggtgcttctatttttaaggcagnnnnnnntatcaatgccttaaattgtattatttctatagaggtttgggatgtcct |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40213468 |
caatcacaagaggctgctactctggtgcttctatttttaaggcagaaaaaaatatcaatgccttaaattgtattatttctatagaggtttgggatgtcct |
40213369 |
T |
 |
| Q |
225 |
tgtagtttttgcactgctatgttttagtaatattaaagcctatcactctttaacttag |
282 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40213368 |
tgtagtttttgcactgctatgttttggtaatattaaagcctatcactctttaacttag |
40213311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University