View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21580_low_41 (Length: 281)
Name: NF21580_low_41
Description: NF21580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21580_low_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 33325255 - 33324985
Alignment:
| Q |
1 |
catgaaacacatggttgcggttccatcagttgcggctcgacataaggcaacacctaatgtaaaaccgccgcaatggaaccttgtaagttgcactgccaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
33325255 |
catgaaacacatggttgcggttccatcagttgcggctcgacataaggcaacacctaatgtaaaaccgccacaattgaaccttgtaagttgcactgccaat |
33325156 |
T |
 |
| Q |
101 |
aagggaatatcttcaatgggaagattgtaattaatgtttggtatgagttgtgacaccaaattagttggtacaaaatcacccaattggttcaaattggtta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33325155 |
aagggaatatcttcaatgggaagattgtaattaatgtttggtatgagttgtgataccaaattagttggtacaaaatcacccaattggttcaaattggtta |
33325056 |
T |
 |
| Q |
201 |
attcttcacatttggcttctaatagaagtgctcctttggcattacaatgaatttcccaccttccacctttg |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33325055 |
attcttcacatttggcttctaatagaagtgctcctttggcattacaatgaatttcccatcttccacctttg |
33324985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 33339499 - 33339769
Alignment:
| Q |
1 |
catgaaacacatggttgcggttccatcagttgcggctcgacataaggcaacacctaatgtaaaaccgccgcaatggaaccttgtaagttgcactgccaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
33339499 |
catgaaacacatggttgcggttccatcagttgcggctcgacataaggcaacacctaatgtaaaaccgccacaattgaaccttgtaagttgcactgccaat |
33339598 |
T |
 |
| Q |
101 |
aagggaatatcttcaatgggaagattgtaattaatgtttggtatgagttgtgacaccaaattagttggtacaaaatcacccaattggttcaaattggtta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33339599 |
aagggaatatcttcaatgggaagattgtaattaatgtttggtatgagttgtgataccaaattagttggtacaaaatcacccaattggttcaaattggtta |
33339698 |
T |
 |
| Q |
201 |
attcttcacatttggcttctaatagaagtgctcctttggcattacaatgaatttcccaccttccacctttg |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33339699 |
attcttcacatttggcttctaatagaagtgctcctttggcattacaatgaatttcccatcttccacctttg |
33339769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University