View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21580_low_43 (Length: 275)
Name: NF21580_low_43
Description: NF21580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21580_low_43 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 98 - 275
Target Start/End: Original strand, 21384033 - 21384210
Alignment:
| Q |
98 |
ttcacgttgcattgatagcagcattcttgtcttggatgatatgatgctatacaaacactataatttagaatgaaaaacaatataactatataatttagaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21384033 |
ttcacgttgcattgatagcagcattcttgtcttggatgatatgatgctatacaaacactataatttagaatgaaaaacaatataactatataatttagaa |
21384132 |
T |
 |
| Q |
198 |
atacaacgaaattatttaaaccacgacatatatgtcacattctctttgatagtaactactaacacatcattacatgca |
275 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21384133 |
atgcaacgaaattatttaaaccacgacatatatgtcacattctctttgatagtaactactaatccatcattacatgca |
21384210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University