View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21580_low_55 (Length: 237)
Name: NF21580_low_55
Description: NF21580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21580_low_55 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 225
Target Start/End: Complemental strand, 42786684 - 42786460
Alignment:
| Q |
18 |
gaacatgacaacaatactagtgagaagtaaaagttcacggtcatt-----------------aacgatgacctagtcaataatatttgataaaaataaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42786684 |
gaacatgacaacaatactagtgagaagtaaaagttcacggtcattcttaatttaacagatgaaacgatgacctaatcaataatatttgataaaaataaga |
42786585 |
T |
|
| Q |
101 |
gaaagtaaatgtgtgctcaaaacttaactcgtattatttttattcattgttgttaaatcttgctcaaaagaacaaagatcaccgtgaatctctgctctac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42786584 |
gaaagtaaatgtgtgctcaaaacttaactcgtattattttcattcattgttgttaaatcttgctcaaaagaacaaagatcaccgtgaatctctgctctac |
42786485 |
T |
|
| Q |
201 |
tttcaagtaggacgtgaatcttgat |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
42786484 |
tttcaagtaggacgtgaatcttgat |
42786460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University