View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21580_low_58 (Length: 233)
Name: NF21580_low_58
Description: NF21580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21580_low_58 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 17 - 149
Target Start/End: Complemental strand, 5194741 - 5194606
Alignment:
| Q |
17 |
atatggtagggtactttttatattaattttttaaatataacgggaacatcatattttggcactttgtttgccatataatatagatttg----nnnnnnnn |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5194741 |
atatggtagggtactttttatattaattttctaaatataacgggaacatcatattttggcac-atgtttgccatataatatagatttgtttttttttttt |
5194643 |
T |
|
| Q |
113 |
gggatatgaaatatgcttgctagttgctacattttca |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5194642 |
gggatatgaaatatgcttgctagttgctacattttca |
5194606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 143 - 216
Target Start/End: Complemental strand, 5189029 - 5188956
Alignment:
| Q |
143 |
attttcaccctttggctcacttctattttcgcacatgctaactacgcagttttgcagtctttattctatatcat |
216 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5189029 |
attttcaccctttggctcacttctattgaagcatctgctaactacgcagttttgcagtctttgctctatatcat |
5188956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University