View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21580_low_60 (Length: 222)
Name: NF21580_low_60
Description: NF21580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21580_low_60 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 34570791 - 34571001
Alignment:
| Q |
1 |
ttgataatttcaactcctttgttattgtccaagaaaattctcaaatgcaatttcgattgagcagattgggcgagttttccttcaagcacgagccacatgt |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34570791 |
ttgataattgcaactcctttgttattgtccaagaaaattctcaaatgcaatttcgattgagcagattgggcgagttttccttcaagcacgacccacatgt |
34570890 |
T |
 |
| Q |
101 |
ctgccaattctgtggatgtatgctttaggaaattgatctcagcatgtccaagtgaaacatcctggtcaaatggaccgtcaaaatcaaaaacttccacata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34570891 |
ctgccaattctgtggatgtatgctttaggaaattgatctcagcatgtccaagtgaaacatcctggtcaaatggaccgtcaaaatcaaaaacttccacata |
34570990 |
T |
 |
| Q |
201 |
caaaactgatg |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
34570991 |
caaaactgatg |
34571001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University