View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21580_low_61 (Length: 220)
Name: NF21580_low_61
Description: NF21580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21580_low_61 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 43179698 - 43179918
Alignment:
| Q |
1 |
aaattaggctcaccactctctgttt-ctctactttttcttttatccttgagccaatctatattgtgtgtttcttgtcttgtcttgtagatgatttacttg |
99 |
Q |
| |
|
||||||||||||| ||||||| ||| |||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43179698 |
aaattaggctcacgactctctattttctctactttttcttttgtcctttggccaatctatattgtgtgtttcttgtcttgtcttggagatgatttacttg |
43179797 |
T |
 |
| Q |
100 |
tatctatctatttatttgtctatttttgttggtagatagcagaaatgataataatgattaagaattcaaacacaattgactaagatggggtttgaacccc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
43179798 |
tatctatctatttatttgtctatttttgttggtagatagccgaaatgataataataattaagaattcaaacacaattgactgagatggggtctgaacccc |
43179897 |
T |
 |
| Q |
200 |
aatcacaacttctaattcatc |
220 |
Q |
| |
|
|||||| ||||||| |||||| |
|
|
| T |
43179898 |
aatcacgacttctagttcatc |
43179918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 120 - 210
Target Start/End: Original strand, 43173551 - 43173643
Alignment:
| Q |
120 |
tatttttgttggtagatagcagaaatgataataatgattaagaattcaaacaca--attgactaagatggggtttgaaccccaatcacaactt |
210 |
Q |
| |
|
||||||| ||||||| ||| |||||||||||||| |||| ||| ||| ||||| ||||| | || |||||||||||||||||||||||||| |
|
|
| T |
43173551 |
tattttttttggtaggtagacgaaatgataataataattaggaactcacacacacaattgaatgagttggggtttgaaccccaatcacaactt |
43173643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University