View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21580_low_63 (Length: 216)
Name: NF21580_low_63
Description: NF21580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21580_low_63 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 132 - 197
Target Start/End: Original strand, 45331531 - 45331596
Alignment:
| Q |
132 |
tgacattccatcattttgtttttgcaaattgacataatgattacaccttatttaaggattactagt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45331531 |
tgacattccatcattttgtttttgcaaattgacataatgattacaccttatttaaggattactagt |
45331596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 22 - 66
Target Start/End: Original strand, 45330475 - 45330518
Alignment:
| Q |
22 |
gaaacaggagggaagaaatcgcaacttcacgttagaaattaggtt |
66 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45330475 |
gaaacaggagggaagaaatcgcaa-ttcacgttagaaattaggtt |
45330518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University