View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21581_high_19 (Length: 322)
Name: NF21581_high_19
Description: NF21581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21581_high_19 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 5 - 322
Target Start/End: Complemental strand, 41681131 - 41680795
Alignment:
| Q |
5 |
agtttggtgttagggtgttaggtggtgcaaatgccaattttcacaatgccaacaagatgttgatcaagtgaaatggaggtggttttttggctatgttcag |
104 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41681131 |
agtttggtgtcagggtattaggtggtgcaaatgccaattttcacaatgccaacaagatgttgatcaagtgaaatggaggtggttttttggctatgttcag |
41681032 |
T |
|
| Q |
105 |
tgtatagacaagtcaacactattgtgcaaagtgagggtaggatgcccatcta-------------------tatttatggttaggcagcgaggttatacc |
185 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41681031 |
tgtatagacaagtcaacactgttctgcaaagtgagggtaggatgcccatctatttttttgtggtttcaatttatttatggttaggcagcgaggttatacc |
41680932 |
T |
|
| Q |
186 |
ttagggatggacattatgttagacactggagtgcagcaaggtgactcgaaggggactctcctttttgctcttgtgttacaccttcttattaattaaatca |
285 |
Q |
| |
|
||| ||||||||||||||| || ||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
41680931 |
ttacggatggacattatgtaagtcactggagtgcagcaagttgacttgaaggggactctcctttttgctcttgtgttacacattcttattaattaaatta |
41680832 |
T |
|
| Q |
286 |
aatacaattgcaagtttttccttcatgcttggtatct |
322 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
41680831 |
aatacaattgcaagttttttcttcatacttggtatct |
41680795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 243 - 319
Target Start/End: Complemental strand, 19280043 - 19279967
Alignment:
| Q |
243 |
ctcctttttgctcttgtgttacaccttcttattaattaaatcaaatacaattgcaagtttttccttcatgcttggta |
319 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||| || | |||| | | | ||||||| || | |||||||||||||| |
|
|
| T |
19280043 |
ctcctttttgctcttgtgttgcaccctcttattcatcatatcagagatagttgcaagcttcttcttcatgcttggta |
19279967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 211 - 275
Target Start/End: Original strand, 6251837 - 6251900
Alignment:
| Q |
211 |
ctggagtgcagcaaggtgactcgaaggggactctcctttttgctcttgtgttacaccttcttatt |
275 |
Q |
| |
|
|||||||||| ||||||||| | |||| || ||||||||||||||| ||||||||| ||||||| |
|
|
| T |
6251837 |
ctggagtgcaacaaggtgacccataggg-acgctcctttttgctcttatgttacaccctcttatt |
6251900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 243 - 319
Target Start/End: Complemental strand, 19036903 - 19036827
Alignment:
| Q |
243 |
ctcctttttgctcttgtgttacaccttcttattaattaaatcaaatacaattgcaagtttttccttcatgcttggta |
319 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||| || | |||| | | | ||||||| || | |||||||||||||| |
|
|
| T |
19036903 |
ctcctttttgctcttgtgttgcaccctcttattcatcatatcagagatagttgcaagcttattcttcatgcttggta |
19036827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University